Repeated DNA Sequences

MEDIUM

Description

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

 

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

 

Constraints:

  • 1 <= s.length <= 105
  • s[i] is either 'A', 'C', 'G', or 'T'.

Approaches

Checkout 3 different approaches to solve Repeated DNA Sequences. Click on different approaches to view the approach and algorithm in detail.

Brute Force

This approach involves a straightforward, nested-loop comparison. We take every possible 10-letter substring and compare it with every subsequent 10-letter substring in the sequence. A HashSet is used to store the found repeated sequences to ensure the final output contains only unique entries.

Algorithm

  • Initialize an empty set result to store the unique repeated sequences.
  • Iterate through the string s with an index i from the beginning up to the point where a 10-letter substring can be formed (s.length() - 10).
  • For each i, extract the substring sub1 = s.substring(i, i + 10).
  • Start a nested loop with an index j from i + 1 to s.length() - 10.
  • In the inner loop, extract the substring sub2 = s.substring(j, j + 10).
  • If sub1 is equal to sub2, it means we have found a repeated sequence. Add sub1 to the result set.
  • To avoid redundant checks for sub1, we can break the inner loop once a match is found.
  • After the loops complete, convert the result set into a list and return it.

The brute-force method is the most intuitive way to solve the problem. We generate all possible 10-letter substrings starting from each index i. For each of these substrings, we then scan the rest of the string from index i+1 onwards to see if an identical substring exists. If a match is found, we add the substring to a HashSet to automatically handle duplicates in the final result. While simple, this method's performance degrades rapidly as the input string size increases due to its O(N^2) nature.

import java.util.ArrayList;
import java.util.HashSet;
import java.util.List;
import java.util.Set;

class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        int n = s.length();
        if (n <= 10) {
            return new ArrayList<>();
        }
        Set<String> result = new HashSet<>();
        // Iterate through all possible start indices of a 10-letter substring
        for (int i = 0; i <= n - 10; i++) {
            String sub1 = s.substring(i, i + 10);
            // Compare with all subsequent 10-letter substrings
            for (int j = i + 1; j <= n - 10; j++) {
                String sub2 = s.substring(j, j + 10);
                if (sub1.equals(sub2)) {
                    result.add(sub1);
                    break; // Found a repeat, no need to check further for sub1
                }
            }
        }
        return new ArrayList<>(result);
    }
}

Complexity Analysis

Time Complexity: O(N^2 * L)Space Complexity: O(K * L)

Pros and Cons

Pros:
  • Simple to conceptualize and implement.
  • Does not require complex data structures.
Cons:
  • Extremely inefficient with a quadratic time complexity, which will likely result in a 'Time Limit Exceeded' error for large inputs.
  • Performs a large number of redundant string comparisons.

Code Solutions

Checking out 5 solutions in different languages for Repeated DNA Sequences. Click on different languages to view the code.

public class Solution {
    public IList < string > FindRepeatedDnaSequences(string s) {
        var cnt = new Dictionary < string,
            int > ();
        var ans = new List < string > ();
        for (int i = 0; i < s.Length - 10 + 1; ++i) {
            var t = s.Substring(i, 10);
            if (!cnt.ContainsKey(t)) {
                cnt[t] = 0;
            }
            if (++cnt[t] == 2) {
                ans.Add(t);
            }
        }
        return ans;
    }
}

Video Solution

Watch the video walkthrough for Repeated DNA Sequences



Patterns:

Sliding WindowBit ManipulationRolling HashHash Function

Data Structures:

Hash TableString

Subscribe to Scale Engineer newsletter

Learn about System Design, Software Engineering, and interview experiences every week.

No spam, unsubscribe at any time.