Repeated DNA Sequences
MEDIUMDescription
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
- For example,
"ACGAATTCCG"is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT" Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA" Output: ["AAAAAAAAAA"]
Constraints:
1 <= s.length <= 105s[i]is either'A','C','G', or'T'.
Approaches
Checkout 3 different approaches to solve Repeated DNA Sequences. Click on different approaches to view the approach and algorithm in detail.
Brute Force
This approach involves a straightforward, nested-loop comparison. We take every possible 10-letter substring and compare it with every subsequent 10-letter substring in the sequence. A HashSet is used to store the found repeated sequences to ensure the final output contains only unique entries.
Algorithm
- Initialize an empty set
resultto store the unique repeated sequences. - Iterate through the string
swith an indexifrom the beginning up to the point where a 10-letter substring can be formed (s.length() - 10). - For each
i, extract the substringsub1 = s.substring(i, i + 10). - Start a nested loop with an index
jfromi + 1tos.length() - 10. - In the inner loop, extract the substring
sub2 = s.substring(j, j + 10). - If
sub1is equal tosub2, it means we have found a repeated sequence. Addsub1to theresultset. - To avoid redundant checks for
sub1, we can break the inner loop once a match is found. - After the loops complete, convert the
resultset into a list and return it.
The brute-force method is the most intuitive way to solve the problem. We generate all possible 10-letter substrings starting from each index i. For each of these substrings, we then scan the rest of the string from index i+1 onwards to see if an identical substring exists. If a match is found, we add the substring to a HashSet to automatically handle duplicates in the final result. While simple, this method's performance degrades rapidly as the input string size increases due to its O(N^2) nature.
import java.util.ArrayList;
import java.util.HashSet;
import java.util.List;
import java.util.Set;
class Solution {
public List<String> findRepeatedDnaSequences(String s) {
int n = s.length();
if (n <= 10) {
return new ArrayList<>();
}
Set<String> result = new HashSet<>();
// Iterate through all possible start indices of a 10-letter substring
for (int i = 0; i <= n - 10; i++) {
String sub1 = s.substring(i, i + 10);
// Compare with all subsequent 10-letter substrings
for (int j = i + 1; j <= n - 10; j++) {
String sub2 = s.substring(j, j + 10);
if (sub1.equals(sub2)) {
result.add(sub1);
break; // Found a repeat, no need to check further for sub1
}
}
}
return new ArrayList<>(result);
}
}
Complexity Analysis
Pros and Cons
- Simple to conceptualize and implement.
- Does not require complex data structures.
- Extremely inefficient with a quadratic time complexity, which will likely result in a 'Time Limit Exceeded' error for large inputs.
- Performs a large number of redundant string comparisons.
Code Solutions
Checking out 5 solutions in different languages for Repeated DNA Sequences. Click on different languages to view the code.
public class Solution {
public IList < string > FindRepeatedDnaSequences(string s) {
var cnt = new Dictionary < string,
int > ();
var ans = new List < string > ();
for (int i = 0; i < s.Length - 10 + 1; ++i) {
var t = s.Substring(i, 10);
if (!cnt.ContainsKey(t)) {
cnt[t] = 0;
}
if (++cnt[t] == 2) {
ans.Add(t);
}
}
return ans;
}
}Video Solution
Watch the video walkthrough for Repeated DNA Sequences
Similar Questions
5 related questions you might find useful
Patterns:
Data Structures:
Companies:
Subscribe to Scale Engineer newsletter
Learn about System Design, Software Engineering, and interview experiences every week.
No spam, unsubscribe at any time.